Coding
Part:BBa_K4769212:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
nprB coding sequence from B. subtilis 3610
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 320
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 320
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 320
Illegal BamHI site found at 270
Illegal XhoI site found at 472 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 320
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 320
Illegal NgoMIV site found at 34 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
N/A
Source
B. subtilis 3610 genome
Primers for cloning: FW: ttgcgcaacttgaccaaga (+ desired overhangs) RV: tcatagaatgccgacagcct (+ desired overhangs)